SubtiBank SubtiBank
yorQ
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.

yorQ

unknown
locus
BSU_20290
pI
8.59
mw
5.82 kDa
protein length
gene length
156 bp Sequence Blast
function
unknown
product
unknown
essential
no
synonyms

Genomic Context

      

categories

  • [category|SW 5|Prophages and mobile genetic elements] → [category|SW 5.1|Prophages] → [category|SW 5.1.2|SP-beta prophage]
  • Gene

    Coordinates
    2,173,956 2,174,111

    Biological materials

    Mutant

  • BKE20290 ([gene|001BF5429FA86D39BC64447929BC20FCBD988C69|yorQ]::erm trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKE20290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAACAATTACCTTTTGAC, downstream forward: _UP4_AAAGTAAGGAAGGTGGAGGA
  • BKK20290 ([gene|001BF5429FA86D39BC64447929BC20FCBD988C69|yorQ]::kan trpC2) available at [http://www.bgsc.org/getdetail.php?bgscid=BKK20290 BGSC], [Pubmed|28189581], upstream reverse: _UP1_ATCAACAATTACCTTTTGAC, downstream forward: _UP4_AAAGTAAGGAAGGTGGAGGA