SubtiBank SubtiBank
Save the date! 20th International Conference on Bacilli and Gram-Positive Bacteria. Washington, D.C. July 23-26, 2019.


72.16 kDa
protein length
667 aa Sequence Blast
gene length
2004 bp Sequence Blast
pentose phosphate pathway

Genomic Context



  • [category|SW 2|Metabolism] → [category|SW 2.2|Carbon metabolism] → [category|SW 2.2.1|Carbon core metabolism] → [category|SW|Pentose phosphate pathway]
  • [category|SW 6|Groups of genes] → [category|SW 6.4|Phosphoproteins] → [category|SW 6.4.8|Phosphorylation on either a Ser, Thr or Tyr residue]
  • Gene

    1,919,861 1,921,864

    The protein

    Catalyzed reaction/ biological activity

  • D-glyceraldehyde 3-phosphate + D-sedoheptulose 7-phosphate --> aldehydo-D-ribose 5-phosphate + D-xylulose 5-phosphate (according to UniProt)
  • Protein family

  • transketolase family (with [protein|EA9FCF84AE4FA80993566B62A9200D4B32AF5670|Dxs], according to UniProt)
  • Modification

  • phosphorylated on ser/ thr/ tyr [Pubmed|16493705]
  • [SW|Cofactors]

  • thiamine pyrophosphate
  • Structure

  • [PDB|3HYL], from B. anthracis
  • additional information

  • belongs to the 100 [SW|most abundant proteins] [PubMed|15378759]
  • Expression and Regulation



    regulatory mechanism

  • [protein|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A]: repression, [Pubmed|14651647], in [regulon|2C54FE2ADC82FF414D732018C90649D477A925AD|Spo0A regulon]
  • regulation

  • repressed under conditions that trigger sporulation ([SW|Spo0A]) [Pubmed|14651647]
  • view in new tab

    Biological materials


  • BS4530 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::aphA3), available in [SW|Jörg Stülke]'s lab
  • BKE17890 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::erm trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCCCTTCCTTA, downstream forward: _UP4_TAAGCTTTTGAAAGAGGATG
  • BKK17890 ([gene|000E237B00539E6850B6A50EE01BA02844B6ACBC|tkt]::kan trpC2) available at [ BGSC], [Pubmed|28189581], upstream reverse: _UP1_CATAAAAATCCCCTTCCTTA, downstream forward: _UP4_TAAGCTTTTGAAAGAGGATG
  • Expression vectors

  • pGP94 (N-terminal Strep-tag, for [SW|SPINE], expression in B. subtilis, in [SW|pGP380]), available in [SW|Jörg Stülke]'s lab
  • for expression, purification in ''E. coli'' with N-terminal Strep-tag, in [SW|pGP172]: pGP820, available in [SW|Jörg Stülke]'s lab, [pubmed|20389117]
  • two-hybrid system

  • B. pertussis adenylate cyclase-based bacterial two hybrid system ([SW|BACTH]), available in [SW|Jörg Stülke]'s lab
  • FLAG-tag construct

  • GP1406 (spc, based on [SW|pGP1331]), available in [SW|Jörg Stülke]'s lab
  • References


  • 9924800,25267444,24929114
  • Original publications

  • 14651647,16493705,19603213,9068642,16143417,15375635,19193632,23568212,23965678,15378759