You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
walJ
5'-3' double-stranded DNA exonuclease, coordination of cell division with DNA replication
Molecular weight
29.77 kDa
Function
coordination of cell division with DNA replication
Product
5'-3' double-stranded DNA exonuclease
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
4,148,851 → 4,149,645
Phenotypes of a mutant
the mutant divides over unsegregated chromosomes more frequently than wild-type cells, and this phenotype is exacerbated when DNA replication is inhibited PubMedincreased sensitivity to a narrow spectrum of cephalosporin antibiotics PubMeddisruption of the corresponding gene in B. anthracis results in a mutator phenotype PubMed The protein
Catalyzed reaction/ biological activity
5'-3' exonuclease activity at the 5' termini and at nicks of double-stranded DNA PubMedthe enzymatic activity of WalJ directly or indirectly affects cell wall metabolism and is required for accurate coordination of cell division with DNA replication PubMed Protein family
predicted member of the metallo-β-lactamase superfamilyCofactors
Expression and Regulation
Biological materials
Mutant
GP3558 (ΔwalJ::aphA3), available in Jörg Stülke's labMGNA-B824 (yycJ::erm), available at the NBRP B. subtilis, Japan1A1044 ( walJ::spec), PubMed, available at [BGhttp://bgsc.org/getdetail.php?bgscid=1A1044]BKE40370 (ΔwalJ::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTGTCTCACTCCATT, downstream forward: _UP4_TAATTTTTCTATGTAAATCABKK40370 (ΔwalJ::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATGTTTGTCTCACTCCATT, downstream forward: _UP4_TAATTTTTCTATGTAAATCA References
Reviews
Loading
Original publications
Loading