You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
spoIIIAH
component of the
SpoIIIA-
SpoIIQ type III secretion system residing in the forespore membrane, required for
SigG activation
Molecular weight
23.58 kDa
Function
activation of
SigG, forespore encasement by the spore coat
Product
part of the transmembrane channel linking the mother cell and the forespore
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,532,353 2,533,009
Phenotypes of a mutant
reduced sporulation efficiency (1 to 10% compared to wild type) PubMedthe spoIIIL spoIIIAH double mutant has a severe sporulation defect (0.001%) PubMedblock of sporulation after engulfment The protein
Catalyzed reaction/ biological activity
required for forespore encasement by the spore coat PubMed Structure
Localization
membrane protein, forms a transmembrane channel linking the mother cell and the forespore (with SpoIIQ) PubMedproper recruitment to the sporulation septum on the mother cell side requires SpoIIQ PubMed Expression and Regulation
Operons
Sigma factors
Regulatory mechanism
Regulation
Additional information
the internal promoter is essential for sporulation, it is twice as active as the promoter in front of spoIIIAA, suggesting that SpoIIIAG and SpoIIIAH are required in larger amounts as compared to the other products of the operon PubMed view in new tabRegulation
Additional information
the internal promoter is essential for sporulation, it is twice as active as the promoter in front of spoIIIAA, suggesting that SpoIIIAG and SpoIIIAH are required in larger amounts as compared to the other products of the operon PubMed view in new tabRegulation
Additional information
the internal promoter is essential for sporulation, it is twice as active as the promoter in front of spoIIIAA, suggesting that SpoIIIAG and SpoIIIAH are required in larger amounts as compared to the other products of the operon PubMed view in new tabBiological materials
Mutant
BKE24360 (spoIIIAH::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCAAACGGTTTGTTTTTTAA, downstream forward: _UP4_TAAGAATGAGGGAAAAAAGCBKK24360 (spoIIIAH::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CCAAACGGTTTGTTTTTTAA, downstream forward: _UP4_TAAGAATGAGGGAAAAAAGC Labs working on this gene/protein
References
Reviews
Loading
Original publications
Loading