You are currently viewing an outdated version of
SubtiWiki.
Please use
the newest version!
gndA
NADP-dependent phosphogluconate dehydrogenase
Molecular weight
51.61 kDa
Function
pentose phosphate pathway
Product
NADP-dependent phosphogluconate dehydrogenase
Genomic Context
Categories containing this gene/protein
Gene
Coordinates
2,480,750 2,482,159
The protein
Catalyzed reaction/ biological activity
6-phospho-D-gluconate + NADP+ --> CO2 + D-ribulose 5-phosphate + NADPH (according to UniProt)Protein family
6-phosphogluconate dehydrogenase family (with YqeC and GntZ, according to UniProt) Paralogous protein(s)
Kinetic information
Modification
phosphorylation on (Thr-15 OR Thr-17) PubMed Effectors of protein activity
inhibited by 4-phosphoerythronate (results from oxidation of erythrose-4-phosphate) PubMed Structure
2W8Z (from Geobacillus stearothermophilus, 83% identity, 92% similarity) PubMed Additional information
Expression and Regulation
Operons
Additional information
Biological materials
Mutant
MGNA-C391 (yqjI::erm), available at the NBRP B. subtilis, JapanGP1514 (gndA::kan), available in Jörg Stülke's labBKE23860 (gndA::erm trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGABKK23860 (gndA::kan trpC2) available at BGSC, PubMed, upstream reverse: _UP1_CATATTCTAACGTCCCTTCT, downstream forward: _UP4_TAATCAATAGAAACCCCCGA Expression vectors
pGP1777 (for expression, purification in E. coli with N-terminal Strep-tag, in pGP172, available in Jörg Stülke's lab)pGP1789 (N-terminal Strep-tag, for SPINE, purification from B. subtilis, in pGP1389) (available in Jörg Stülke's lab)GP1408 (gndA-Strep (spc)) & GP1410 (gndA-Strep (cat)), purification from B. subtilis, for SPINE, available in Jörg Stülke's lab Two-hybrid system
B. pertussis adenylate cyclase-based bacterial two hybrid system (BACTH), available in Jörg Stülke's lab FLAG-tag construct
GP1403 (spc, based on pGP1331), available in Jörg Stülke's labGP1408 (kan, resistance cassette exchange in GP1403), available in Jörg Stülke's lab References
Loading